diff_months: 22

Bioinformatics, PCR Cloning and DNA Manipulation Laboratory Report

Download Solution Now
Added on: 2024-11-13 19:00:25
Order Code: SA Student Caroline Science and Maths Assignment(3_24_40849_634)
Question Task Id: 503555

Bioinformatics, PCR Cloning and DNA Manipulation Laboratory Report

PART I: DNA cloning and Manipulation practical write upIntroduction: 300 words equivalent (20 marks)

Provide a brief introduction to molecular cloning. Provide information on the uses of GST fusion proteins in in vitro molecular biology experiments.

Molecular cloning is a fundamental technique in molecular biology that involves creating recombinant DNA molecules by inserting a gene of interest into a vector plasmid for replication in a host organism. This technique has significantly impacted various scientific fields, enabling the manipulation and study of genes, proteins, and their functions Bell et al. (2013) Williams et al., 2020). One important application of molecular cloning is the production of fusion proteins, such as Glutathione S-Transferase (GST) fusion proteins, which have been widely utilized in in vitro molecular biology experiments (RoeckleinCanfield & Lopilato, 2004). GST fusion proteins have demonstrated value in a different array of cell types, including E. coli, yeast, and plants. These fusion proteins are valuable for tasks such as protein purification, protein-protein interaction studies, and improving the solubility and stability of recombinant proteins (Williams et al., 2020; RoeckleinCanfield & Lopilato, 2004). The GST system, comprising a 26 kDa sequence of 211 amino acid, facilitates the expression and purification of recombinant proteins due to its size, tertiary structure, and hydrophilicity (Williams et al., 2020). Furthermore, the use of GST fusion proteins has led to the development of protein nano sensors, highlighting the adaptability and innovation in leveraging these fusion proteins for various applications (Williams et al., 2020). Overall, the integration of GST fusion proteins in molecular cloning experiments has significantly improved the efficiency and outcomes of in vitro studies. These fusion proteins continue to play a vital role in advancing research in molecular biology, protein biochemistry, and related fields.

Molecular cloning is a technique used to replicate and manipulate DNA fragments. It involves the transfer of a DNA fragment of interest from one organism to a self-replicating genetic element such as a plasmid, which can then be propagated in a host organism such as bacteria. Cloning is widely used in many fields of biological research, including genetic engineering, gene therapy, and functional genomics.

Glutathione S-transferase (GST) is a commonly used fusion partner in molecular biology experiments. GST is a protein that binds to glutathione, a tripeptide composed of glutamate, cysteine, and glycine. Fusion proteins are created by joining a protein of interest to the GST protein. The GST fusion protein can be easily purified using glutathione-affinity chromatography, a process that exploits the affinity of GST for glutathione. GST-fusion proteins are commonly used in in vitro molecular biology experiments, such as protein-protein interaction studies, enzyme assays, and antibody production.

Method: 75 words equivalent (5 Marks)

Provide a methods section on Agarose gel electrophoresis (Refer to the protocol on Canvas, only write anything in detail if the method was changed/modified during the practical session)

Agarose gel electrophoresis was conducted following a standard protocol. A 1% agarose gel was prepared by dissolving 1g of agarose powder in 100mL of 1X TAE buffer. The mixture was microwaved until the agarose was completely melted. Subsequently, 6l of GelRed stain was added to the solution. The gel was poured into a gel tray with a 16-well comb and allowed to set for approximately 20 minutes. Once set, the gel was placed in the electrophoresis tank and covered with 1X TAE buffer. A DNA marker was loaded into one well, and 5l of the PCR product mixed with loading dye was loaded into an adjacent well. The gel was run at 150V for 30-40 minutes. Visualization of DNA bands was performed under UV light with the assistance of the demonstrator.

B) Methods: PCR and Electrophoresis of GST DNA:

PCR Amplification of GST DNA:

Prepare a PCR reaction mixture containing Taq polymerase, dNTPs, and primers specific for the GST gene.

Add genomic DNA or cDNA as a template for amplification.

Use a thermal cycler to amplify the GST gene by performing 30-35 cycles of denaturation, annealing, and extension.

Visualize the PCR product on an agarose gel stained with ethidium bromide.

Electrophoresis of GST DNA:

Prepare a 1% agarose gel in TAE buffer.

Add ethidium bromide to the gel and allow it to solidify.

Load the PCR product and a DNA ladder onto the gel.

Run the gel at a constant voltage for 30-40 minutes.

Visualize the DNA fragments using UV light.

Results: 375 words equivalent (25 marks)

Provide a results section consisting of a brief written description of the results and annotated figures of the gels that you produced during the trimester. Include a figure legend for each figure.

Figure 1: Results of the amplification of GST DNA by PCR

287337517018000016891000

Figure 2: Results of Colony PCR

Figure 3: Results restriction enzyme mapping of plasmid DNA

762016767300

Figure 4: Results showing analysis of expressed GST protein using SDS-PAGE

-8863318344800

-296378167Reference:

00Reference:

Discussion: 300 words equivalent (20 marks)

Discuss the experimental results provided in Figures 1-4.

PART II: Bioinformatics

NOTE: This section will involve pasting a large amount of DNA and Protein sequences. It is recommended that you adjust the font size of these sequences to 8. Ensure that your DNA sequences and alignments are appropriately formatted.

Sequence manipulation (10 marks)

Provide an alignment (Figure 5) of the DNA sequence and corresponding protein sequence of GST from the start codon to the stop codon. Ensure that the sequences are correctly aligned so that each amino acid residue is matched to its codon. Include a figure legend.

Provide an alignment (Figure 6) of the DNA sequence with the corresponding protein sequence of Protein A (accession number: X02760.1). Include a figure legend.

Provide an alignment (Figure 7) of the DNA sequence with the corresponding protein sequence of Protein B (accession number: V00595.1) Include a figure legend.

Provide a figure (Figure 8) showing the alignment of the amino acid sequences of Protein A and Protein B. Include a figure legend.

Identify the two proteins (A and B). Use your bioinformatics skills to identify similar and dissimilar structures or domains of the two proteins. Speculate as to how different regions of the proteins contribute to protein function? (5 marks for sequence alignments, 5 marks for identification of the proteins and further bioinformatics assessment)

Analysis of gene X (20 Marks)

The following DNA sequence has been identified and named gene X. It is thought that this sequence codes for a single protein. Design 5 and 3 PCR primers that will amplify ONLY the open reading frame of the genes. Give these sequences in a 5 to 3 orientation. Include PstI and SacI restriction enzyme recognition sites on the 5 ends of the 5 and 3 primers respectively. Provide an accurate PCR program that will amplify the sequence based on the primers you designed. Provide the amino acid sequence of the protein encoded by the gene. Provide details of the theoretical molecular weight and isoelectric point of the protein. Use your bioinformatics skills to provide details of the TM regions of the proteins. Name the protein and provide a brief description of its role in health and disease. Remember to label figures appropriately and provide figure legends.

>Gene_XCGCGCGCTGCCTGAGGACGCCGCGGCCCCCGCCCCCGCCATGGGCGCCCCTGCCTGCGCCCTCGCGCTCTGCGTGGCCGTGGCCATCGTGGCCGGCGCCTCCTCGGAGTCCTTGGGGACGGAGCAGCGCGTCGTGGGGCGAGCGGCAGAAGTCCCGGGCCCAGAGCCCGGCCAGCAGGAGCAGTTGGTCTTCGGCAGCGGGGATGCTGTGGAGCTGAGCTGTCCCCCGCCCGGGGGTGGTCCCATGGGGCCCACTGTCTGGGTCAAGGATGGCACAGGGCTGGTGCCCTCGGAGCGTGTCCTGGTGGGGCCCCAGCGGCTGCAGGTGCTGAATGCCTCCCACGAGGACTCCGGGGCCTACAGCTGCCGGCAGCGGCTCACGCAGCGCGTACTGTGCCACTTCAGTGTGCGGGTGACAGACGCTCCATCCTCGGGAGATGACGAAGACGGGGAGGACGAGGCTGAGGACACAGGTGTGGACACAGGGGCCCCTTACTGGACACGGCCCGAGCGGATGGACAAGAAGCTGCTGGCCGTGCCGGCCGCCAACACCGTCCGCTTCCGCTGCCCAGCCGCTGGCAACCCCACTCCCTCCATCTCCTGGCTGAAGAACGGCAGGGAGTTCCGCGGCGAGCACCGCATTGGAGGCATCAAGCTGCGGCATCAGCAGTGGAGCCTGGTCATGGAAAGCGTGGTGCCCTCGGACCGCGGCAACTACACCTGCGTCGTGGAGAACAAGTTTGGCAGCATCCGGCAGACGTACACGCTGGACGTGCTGGAGCGCTCCCCGCACCGGCCCATCCTGCAGGCGGGGCTGCCGGCCAACCAGACGGCGGTGCTGGGCAGCGACGTGGAGTTCCACTGCAAGGTGTACAGTGACGCACAGCCCCACATCCAGTGGCTCAAGCACGTGGAGGTGAACGGCAGCAAGGTGGGCCCGGACGGCACACCCTACGTTACCGTGCTCAAGACGGCGGGCGCTAACACCACCGACAAGGAGCTAGAGGTTCTCTCCTTGCACAACGTCACCTTTGAGGACGCCGGGGAGTACACCTGCCTGGCGGGCAATTCTATTGGGTTTTCTCATCACTCTGCGTGGCTGGTGGTGCTGCCAGCCGAGGAGGAGCTGGTGGAGGCTGACGAGGCGGGCAGTGTGTATGCAGGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGCCGCCTGCGCAGCCCCCCCAAGAAAGGCCTGGGCTCCCCCACCGTGCACAAGATCTCCCGCTTCCCGCTCAAGCGACAGGTGTCCCTGGAGTCCAACGCGTCCATGAGCTCCAACACACCACTGGTGCGCATCGCAAGGCTGTCCTCAGGGGAGGGCCCCACGCTGGCCAATGTCTCCGAGCTCGAGCTGCCTGCCGACCCCAAATGGGAGCTGTCTCGGGCCCGGCTGACCCTGGGCAAGCCCCTTGGGGAGGGCTGCTTCGGCCAGGTGGTCATGGCGGAGGCCATCGGCATTGACAAGGACCGGGCCGCCAAGCCTGTCACCGTAGCCGTGAAGATGCTGAAAGACGATGCCACTGACAAGGACCTGTCGGACCTGGTGTCTGAGATGGAGATGATGAAGATGATCGGGAAACACAAAAACATCATCAACCTGCTGGGCGCCTGCACGCAGGGCGGGCCCCTGTACGTGCTGGTGGAGTACGCGGCCAAGGGTAACCTGCGGGAGTTTCTGCGGGCGCGGCGGCCCCCGGGCCTGGACTACTCCTTCGACACCTGCAAGCCGCCCGAGGAGCAGCTCACCTTCAAGGACCTGGTGTCCTGTGCCTACCAGGTGGCCCGGGGCATGGAGTACTTGGCCTCCCAGAAGTGCATCCACAGGGACCTGGCTGCCCGCAATGTGCTGGTGACCGAGGACAACGTGATGAAGATCGCAGACTTCGGGCTGGCCCGGGACGTGCACAACCTCGACTACTACAAGAAGACAACCAACGGCCGGCTGCCCGTGAAGTGGATGGCGCCTGAGGCCTTGTTTGACCGAGTCTACACTCACCAGAGTGACGTCTGGTCCTTTGGGGTCCTGCTCTGGGAGATCTTCACGCTGGGGGGCTCCCCGTACCCCGGCATCCCTGTGGAGGAGCTCTTCAAGCTGCTGAAGGAGGGCCACCGCATGGACAAGCCCGCCAACTGCACACACGACCTGTACATGATCATGCGGGAGTGCTGGCATGCCGCGCCCTCCCAGAGGCCCACCTTCAAGCAGCTGGTGGAGGACCTGGACCGTGTCCTTACCGTGACGTCCACCGACGAGTACCTGGACCTGTCGGCGCCTTTCGAGCAGTACTCCCCGGGTGGCCAGGACACCCCCAGCTCCAGCTCCTCAGGGGACGACTCCGTGTTTGCCCACGACCTGCTGCCCCCGGCCCCACCCAGCAGTGGGGGCTCGCGGACGTGAAGGGCCACTGGTCCCCAACAATGTGAGGGGTCCCTAGCAGCCCTCCCTGCTGCTGGTGCA

PCR primer sequences for gene X

5 primer 3 primer

  • Uploaded By : Pooja Dhaka
  • Posted on : November 13th, 2024
  • Downloads : 0
  • Views : 327

Download Solution Now

Can't find what you're looking for?

Whatsapp Tap to ChatGet instant assistance

Choose a Plan

Premium

80 USD
  • All in Gold, plus:
  • 30-minute live one-to-one session with an expert
    • Understanding Marking Rubric
    • Understanding task requirements
    • Structuring & Formatting
    • Referencing & Citing
Most
Popular

Gold

30 50 USD
  • Get the Full Used Solution
    (Solution is already submitted and 100% plagiarised.
    Can only be used for reference purposes)
Save 33%

Silver

20 USD
  • Journals
  • Peer-Reviewed Articles
  • Books
  • Various other Data Sources – ProQuest, Informit, Scopus, Academic Search Complete, EBSCO, Exerpta Medica Database, and more